February 23

Lab 7: PCR and Gel Electrophoresis 2/22/18

Purpose:

The purpose of this lab was to prepare our DNA for amplification and to begin the set up for making gel electrophoresis. We started out by learning how to make our agarose gel in order to prepare it for the analyzing next class. This lab is supposed to help introduce us to PCR primers and learning the process of analyzing DNA.

Procedure:

  • Begin by cleaning your area with bleach.Obtain 3 tubes of already filled with 12.5ul of 2x Master Mix. Label each tube with pos., neg. and S.
    • For each of the tubes add 1ul of COX1 forward and reverse primers using a p10 pipette
    • For the negative control add 12.5ul of 2x Master Mix, 1ul of primer, and 11.5ul of water
    • For the positive control add 12.5ul of 2x Master Mix, 5.0ul of positive DNA, 1.0ul of primer, and 6.5ul of water
    • For the DNA tube add 12.5ul of Master Mix, 5.0ul of DNA, 1.0ul of primer, and 6.5ul of water
    • When finished, make sure the tubes are labeled and have your instructor store them away for next week
  1. Begin making Agarose gel:
    1. Measure out 0.6 grams of Agarose. Add to 40 mL of T.A.E. Swirl the erlenmeyer flask with the solution to begin to mix. Cover the flask with weighing paper and a small plastic cap to prevent contamination.
    2. Microwave the flask apparatus for 1 minute and 20 seconds. Remove carefully, solution is boiling.
    3. Place flask into a water bath at 55 degrees C for 5 minutes to allow it to cool.
    4. Ask your instructor to add 2 μl of ethidium bromide to the flask, swirl the solution to mix.
    5. Once mixed, pour the solution into a gel rack to sit, cool, and harden into gel to be used for gel electrophoresis next week. Store away in proper place in the classroom and clean your lab area.

Data:

Component Volume of Negative Volume of Positive Volume of Soil DNA Tube
2X Master Mix 12.5 μl 12.5 μl 12.5 μl
DNA template 0.0 μl 5.0 μl 5.0 μl
Primers 1.0 μl 1.0 μl 1.0 μl
Water 11.5 μl 6.5 μl 6.5 μl
Total volume 25.0 μl 25.0 μl 25.0 μl
  • Once we made these solutions we prepared the agarose gel for next week’s analyzing of the DNA.
  • Our template was DNA and the concentration was 80ng/ul
  • Our final concentration of DNA was 450ng
  • Our forward primer was 5′ ATGTGAGTTGATTTTATAGAGCAGA 3′
  • Our reverse primer was 5′ GGDATACCRTTCATTTT 3′
  • Our tubes are labeled with a 7 and pos, neg, and DNA and our initials SAM
  • Our gel is labeled Adair, SAM, and rm A127

Conclusion:

Overall, we were able to prepare our agarose gel and store it at 4C for next class. We were able to learn about what the primers we were using. I am very curious to see what happens when we run and analyze the gel. I am hoping that we will be able to see the DNA clearly.

Category: Anna Schiavone | LEAVE A COMMENT
February 23

Lab 7: PCR Protocol 2/22/18

PURPOSE: the purpose of this lab was to explore PCR and prepare the gel for gel electrophoresis for next class. The purpose of PCR is to amplify a segment of DNA via the use of specific primers that bind at a specific area on the strand of DNA and then replicate it. We do this in order to have enough DNA to run gel electrophoresis and get results.

PROTOCOL:

PCR:

  1. Review the QTM and determine the volumes needed for each of the tubes. We will have a positive control, a negative control, and an experimental tube.
  2. To the positive control tube add 12.5 ul of 2X master mix, 5 ul of Paramecium DNA template, 1ul COX1 primers, and 6.5 ul of water to equal a total volume of 25ul.
  3. To the negative control tube add 12.5 ul of 2X master mix, NO DNA TEMPLATE, 1ul COX1 primers, and 11.5 ul of water to equal a total volume of 25ul.
  4. To the experimental tube add 12.5 ul of 2X master mix, 5 ul of extracted soil ciliate DNA template, 1ul COX1 primers, and 6.5 ul of water to equal a total volume of 25ul.

PCR Cycling conditions:

  1. run at 94C for 4 mins
  2. 5 cycles of denaturation at 94C for 30s, annealing at 45C for 1 min and extension at 72C for 105 sec
  3. 35 cycles of denaturation at 94C for 30 s, annealing at 55C for 1 min and extension at 72C for 105 sec
  4. Hold at 72C for 10 min

Gel Electrophoresis:

  1. To make a 1.5% agarose gel, add .6g agrose to 40ml 1xTAE in an Erlenmeyer flask.
  2. lightly cover the top of the flask with a piece of the weighing paper so that the solution does not boil over.
  3. Put the flask in the microwave for 1:30 sec on 70 power or just until the solution begins to boil
  4. Once the solution begins to boil, remove and put in an ice bath so that it is easier to handle
  5. Once the solution and glass have cooled add 2 ul ethidium bromide into the solution and swirl
  6. pour the solution into the mold and allow to solidify for 25-30 mins.
  7. if not using immediately, store in the fridge

RESULTS:

sequence of forward primer: 5′-ATGTGAGTTGATTTTATAGAGCAGA-5′

sequence of reverse primer: 5′-GGDATACCRTTCATTTT-3′

Component Volumme + Control (P) Volumme – Control (N) Volume Soil DNA (E)
2x Master mix 12.5 ul 12.5ul 12.5ul
DNA Template 0ul 5ul 5ul
Primers 1ul 1ul 1ul
Water 11.5ul 6.5ul 6.5ul
Total Volume 25ul 25ul 25ul

Tube “P”: 25ul (DNA concentration 10ng/ul)

Tube “N”: 25ul

Tube “E”: 25ul (DNA concentration 164 ng/ul?????)

*concentration of primers in tubes= .4uM

Stored in rack: A10, A11, A12

Mass agrose: .6g

Volume 1xTAE: 4oml

CONCLUSION:

We still aren’t sure that this protocol is the best for soil ciliate especially since our personal nucleic acid concentrations weren’t originally good from the EZNA protocol. The next step is to run the gel electrophoresis and compare our data in order to identify the ciliates present. We must keep in mind that the positive control is going to have mainly all 1-2 types of paramecium where as ours most likely contains many different organisms which is why we used our specific primers however this might result in faulty results.

 

Category: Natalie Shugert | LEAVE A COMMENT
February 23

February 22, 2018 – Lab 7: PCR Prep and Gel Creation

Objective:

The purpose of today’s lab is to prep our soil DNA for PCR and to create a positive negative control to test our results. The other purpose of today’s lab is to create our gel for gel electrophoresis. By doing this, we are one step closer to getting our DNA sequenced for metabarcoding.

Procedure:

PCR Prep:

  1. Clear desk and use gloves and wash prep area with 10% bleach
  2. Obtain 3 mini tubes filled with 12.5μL of 2X master mix
  3. Label each one: One for negative control, one for positive control, and one for soil ciliates
  4. For the negative control, pipet 11.5μL of deionized water into the mini tube
  5. For the positive control and soil DNA, pipet 6.5μL of deionized into the respective mini tubes
  6. For the positive control tube, pipet 5μL of 10 ng/mL stock solution containing paramecium
  7. For the soil DNA, pipet 5μL of extracted DNA into the mini tube
  8. In all of the tubes, pipet 1μL of cox1 forward and reverse primers and store
  9. Label the top of the mini tubes with group number
  10. Place on a rack and have everyone in the group put down their initials under our group number
  11. Record what place on the rack where each sample was stored

Agarose Gel Prep:

  1. Mass out 0.6g of agarose powder on a scale using wax paper and add to Erlenmeyer flask
  2. Measure our 40mL of T.A.E. solution and add to Erlenmeyer flask. Place wax paper our flask and cap it. Swirl to mix
  3. Microwave flask for 1 minute and 20 seconds (or until it boils)
  4. Place into a cooling bath at 55 degrees Celsius for 5 minutes
  5. Add 2μL of ethidium bromide to the flask. Swirl to mix
  6. Assemble the gel rack
  7. Pour the solution into the assembled gel rack
  8. Label gel rack with tape that indicates the corresponding group number

Data:

Component Negative Control Positive Control  Soil DNA
2X Master Mix 12.5 μl 12.5 μl 12.5 μl
DNA template 0.0 μl 5.0 μl 5.0 μl
Primers 1.0 μl 1.0 μl 1.0 μl
Water 11.5 μl 6.5 μl 6.5 μl
Total volume 25.0 μl 25.0 μl 25.0 μl

For our tubes, we labeled the negative control with a “-“, our positive control had a “+” symbol, and our soil DNA was labeled “s”. All of our mini tubes were labeled with a “7” on the top of it to indicate our group number. The mini tubes positive, negative and soil were placed on a small rack on spots “A1, A2, and A3” respectively. Our initials were put on the group 7 line. The agarose was exactly 0.6g, and our T.A.E. Our gel rack was labeled “Group 7” on the front of it with tape and was left to solidify on our lab desk.

Pictures:

Conclusion:

Today’s lab was pretty straightforward, yet it was fun to finally make gel. We talked about it in lecture and I’ve head of it, but I’ve never actually seen it for made it. The pre-lab taught me a lot how some advanced lab technology works and the intricacies of gel electrophoresis. Today’s lab was one of the more productive ones; we got everything done and we learned a lot. I can’t wait until we get to the final step, which is metabarcoding.

 

Category: Steven Sanders | LEAVE A COMMENT
February 23

Lab 7 PCR and Gel Electrohporesis

Lab 7 PCR Protocol and Gel Electrophoresis 2/22/2018

Purpose

The purpose of this lab was to amplify our DNA through the PCR process by denaturing, annealing, and elongating our  samples. After that we started the process of gel electrophoresis by making our mold for next week.

Process

Since the DNA extraction protocol was finished by our TAs (THANK YOU) we started right on the PCR protocol after reviewing the basic steps of what it does. We figured out the amount of DNA, primer, and water we would need in each tube and then mixed all of them. The primers consisted of a forward and reverse primer from the COX1 gene. After all these components were added into the negative control, positive control, and DNA tube we handed them off to be denatured. Group 5s tubes are in B1,2, and 3. The chart of our values is shown in the data section below. After this, We mixed 40 mL of fluid with .6g of agarose gel to make a 1.5% concentration mixture of gel for our electrophoresis mold. We microwaved the mixture, placed it in a water bath, and poured the slightly cooled mixture into the tubes. Our tray has a slight dip in the middle that could possible be a problem when we do the electrophoresis.

Data

note the dip toward the back of the gel plate

Conclusion

This lab was one of my favorites so far. I’m excited to see the results of the PCR process. Hopefully, there won’t be a problem with it because we didn’t get the results we wanted from the Nanodrop. We will be able to tell if it effected it by comparing it to our Paramecium positive control. Next we will unfreeze our DNA and start the electrophoresis phase. Group 5’s tray is stored in the fridge with the others labelled “LSKG5”

Category: Lindsay Haag, Uncategorized | LEAVE A COMMENT
February 23

Agarose Gel Electrophoresis 2/22/18

Purpose: Prepare negative and positive samples as well as the soil DNA samples in order to go through PCR amplification. Also, prepare the agarose gel and wells in order to conduct gel electrophoresis.

Procedure

-Preparing the Controls and Soil Sample

  1. All students must be wearing gloves and be careful not to contaminate the samples
  2. Clean the work area using bleach
  3. Label the 3 different tubes containing 12.5 uL of 2X master mix with + (positive control) , – (negative control) and S (soil sample)
  4. Add the appropriate amount of culture, primers and water to each tube
  5. Mixtures
    1. Positive Control: 1 uL of Cox1 primers/ 5 ul of 10ng/ul culture/ 6.5 ul of deionized water
    2. Negative Control: 1 ul of Cox1 primers/ 11.5 ul of deionized water
    3. Soil Sample: 1 ul of Cox1 primers/ 5 uL of eDNA smaple/ 6.4 ul of deionized water
  6. Micropipette each solution using a different tip
  7. place all three tubes in a tray with each tube labled with group number

-Preparing Agarose Gel

  1. Add 40 mL of 1x TAE to 0.6g agarose in a small Erlenmeyer flask
  2. Mix it for a bit and put in the microwave (put the weigh paper on top then loosely put the cap on the flask)
  3. Microwave the flask for 1 minute and 20 seconds under power 7
  4. Gently swirl the sample and place it in the water bath for 5 minutes
  5. While the sample is being cooled, set up the gel electrophoresis box, making sure the open ends are sealed
  6. After the flask is cooled, add 2uL of ethidium bromide (Done by the instructor)
  7. Swirl the mixture and gently pour it into the prepared mold.
  8. Allow it to solidify for a few minutes
  9. Cover the gel with prepared buffer solution so it would not dry out
  10. Label box and turn it into the L.A.

Results

Each tube labeled +,-, S. All were labeled with #3 and stored in the tray.

Gel electrophoresis box was labeled JJN #3 and turned it into L.A.

Gel electrophoresis would be conducted in next week’s lab

Conclusion

It was interesting to see the actual process of creating the agarose gel. I am excited to actually use the DNA samples and conduct gel electrophoresis for each sample that is made. Also, it was interesting to see each process in detail and learn what each chemical does. For example, the primers are there to aid in the process of PCR amplification and allow DNA polymerase to bind to the correct place in the DNA. Also, ethidium bromide is added to allow to visualize the movement of DNA across the gel.

Category: Jae Lee | LEAVE A COMMENT
February 23

Lab #6: CO1 PCR DNA Amplification and Gel Electrophoresis 2/22/18

Purpose: The purpose of this lab was to prepare to amplify our DNA using PCR by mixing our template DNA with nucleotides, buffer, DNA polymerase and specific primers. In lab, we learned more about the process of PCR and how to amplify our COX1 primers. In addition, we gained new knowledge about what the COX1 primer is, reviewed our final goal of determining what is in our soil, and learned about how to make the gel for gel electrophoresis.

Procedure A:

  1. Review QTM sheet and redraw the process of PCR
  2. Clean table and work space with bleach to create a more sterile environment
  3. Complete components table on QTM
  4. Use the 2xMaster mix,  DNA template, primers, and water and mix components

Procedure B: Agarose Gel

  1. Make 1.5 % agarose gel
    1. Add 40 ml 1xTAE to .6g agarose in small Erlenmeyer flask
    2. Cover lightly with weighting paper and loose-fitting cap (Do not make cap to tight)
    3. Heat until solution is clean and small bubbles come off the bottom when gently swirled
    4. Allow to cool until the flask is comfortable to hold (5-6minutes)
    5. Have your TA add 2 ul ethidium bromide and swirl gently
  2. Set up gel electrophoresis box, making sure the open ends are sealed
  3. Pour agarose gel smoothly into prepared mold, with as few bubbles as possible. Insert the comb with its back towards the nearest edge and allow it to solidify for at least 25-30 minutes
  4. Cover gel with prepared 1xTAE buffer solution so that it will not dry out
  5. Carefully remove comb and turn gel so that the wells are furthest away from positive electrode
  6. Using a micropipetter, add 5 ul of the ladder and 10 ul of each PCR product + loading buffer. If the loading buffer is not included in the Taq polymerase used in the PCR + loading buffer. If the loading buffer is not included in the Taq polymerase used in the PCR, add 5 ul loading buffer to the PCR product and mix thoroughly before transferring the gel
  7. After you have loaded your sample, place the lid on your box and turn on the power supply to approximately 100 volts. Allow to run for 30 minutes or more, allowing the loading dye to run approximately halfway across the gel before turning off the power.
  8. Image with UV light

Data and Observations:

  • Amount of primer to be placed in tube was determined using the following calculations
    • C1V1 = C2V2
    • 2.5ul/25uM = Xul/10uM
    • X = 1 uL of H2O
  • Calculation to determine grams of agarose needed
    • Xg agarose/ 40ml buffer = .015
    • X = (40)(.015) = 0.6 grams of agarose
  • Gel for gel electrophoresis labeled C.C. 21 and placed in fridge for storage
  • Tubes Labeled +, -, and DNA.
    • + Tube = Well C4
    • – Tube = Well C5
    • DNA Tube = Well C6
  • Notes from PCR class review
    • 94-96 degrees C is the temperature for denaturation
    • 68 degrees C is the temperature for annealing
    • 72 degrees C is the temperature for elongation
    • Goal of Experiment = to determine how many things are there and what these things are
    • Use bleach and wear gloves to keep the workspace as sterile as possible to keep your DNA from being amplified
    • COX1 is a small piece of DNA in the mitochondria and is variable because it has a high rate of mutation
  • Components Table: Negative Tube: Total Volume = 25uL
    • 12.5 uL of 2x Master mix
    • 0 uL of DNA template
    • 1 uL of primers
    • 11.5 uL of water
  • Components Table: Positive Tube: Total Volume = 25uL
    • 12.5 uL of 2x Master mix
    • 5 uL of 10ng/uL DNA template
    • 1 uL of primers
    • 6.5 uL of water
  • Components Table: Soil DNA Tube: Total Volume = 25uL
    • 12.5 uL of 2x Master mix
    • 5 uL of ? DNA template
    • 1 uL of primers
    • 6.5 uL of water

Conclusion: This lab allowed us to learn more about PCR, the amplification of genes, and gel electrophoresis. During the lab, our group accidentally pipetted 11.5 uL of primers into one of our tubes rather than the correct 1uL amount. However, we started that tube again and did not face any other problems. The next step in our experiment is to add DNA to the gel we made and perform gel electrophoresis. Our tubes are labeled +, -, and DNA and the gel for gel electrophoresis was labeled C.C. 21 and was placed in a fridge for storage.

Category: Emma Nidermaier | LEAVE A COMMENT
February 23

2/22/18- PCR Amplification Process and Making Agarose Gel

Purpose:

The purpose of this lab was to prepare both positive and negative control samples, as well as our soil DNA samples in tubes to be put through the PCR amplification process of denaturation, annealing, and elongation. In addition, we discussed and learned the details of the PCR amplification process to ensure that everyone in the class had a clear understanding of how we would be amplifying the DNA we found in our samples. We discussed the possibility of skewed results, due to our unreliable and questionable results of testing for DNA in our samples. It is possible that our cell layers were contaminated by other substances in the DNA extraction procedure and this is what is causing our results to be unreliable and unusual. Therefore, when we run PCR it is possible that other cells’ DNA, not just ciliates, will be amplified in the process as well. Lastly, an objective of this lab was to make an agarose gel that we would be using for gel electrophoresis on our amplified DNA samples in next week’s lab.

 

Procedure:

  1. Discuss Learning Objectives of the lab and the details behind the PCR amplification process.
  2. Discuss the results of analyzing our DNA concentrations from the samples that we were able to extract using the procedure from last week’s lab.
  3. Begin preparation for the PCR procedure:
    1. Obtain 3 tubes already filled with 12.5 μl of 2x Master Mix. Label each of these tubes with a +,-, and S to indicate which tube will be the positive control, negative control, and soil DNA sample tube. The master mix consists of the appropriate buffer, DNA nucleotides, and Taq polymerase. Perform each of the following steps quickly and carefully, so as to limit the amount of DNA exposure and contamination throughout the experiment.
      1. For each of the tubes, add 1 μl of COX 1 forward and reverse primers using a micropipette.
      2. For the negative control tube: pipette 11.5 μl of deionized water into the solution. No DNA template will be added to this tube. Set aside once its preparation has been completed and it has a total of 25 μl.
      3. For the positive control: pipette 5 μl of the DNA template stock solution of Paramecium (concentration of 10 ng/mL) into the solution. In addition, pipette 6.5 μl of deionized water into the solution, to reach a total of 25 μl in the tube. Set aside for storage.
      4. For the soil DNA sample tube: pipette 5 μl of the extracted DNA from our soil samples into the solution (concentration unknown and unreliable.) In addition, pipette 6.5 μl of deionized water into the solution, to reach a total of 25 μl in the tube. Set aside for storage.
      5. Place the three tubes in the class rack at the front of the room. Record the location of your tubes in the rack and what you indicated each of them with. Our tubes are labeled with a “7” on the lid and are located in slots A1, A2, and A3 in the rack.
  4. Begin making Agarose gel:
    1. Measure out 0.6 grams of Agarose. Add to 40 mL of T.A.E. Swirl the erlenmeyer flask with the solution to begin to mix. Cover the flask with weighing paper and a small plastic cap to prevent contamination.
    2. Microwave the flask apparatus for 1 minute and 20 seconds. Remove carefully, solution is boiling.
    3. Place flask into a water bath at 55 degrees Celcius for 5 minutes to allow it to cool.
    4. Add 2 μl of ethidium bromide to the flask, swirl the solution to mix.
    5. Once mixed, pour the solution into a gel rack to sit, cool, and harden into gel to be used for gel electrophoresis next week. Store away in proper place in the classroom and clean your lab area.

 

Data:

Component Volume of Negative Control Tube Volume of Positive Control Tube Volume of Soil DNA Tube
2X Master Mix 12.5 μl 12.5 μl 12.5 μl
DNA template 0.0 μl 5.0 μl 5.0 μl
Primers 1.0 μl 1.0 μl 1.0 μl
Water 11.5 μl 6.5 μl 6.5 μl
Total volume 25.0 μl 25.0 μl 25.0 μl

 

Once we completed our preparation for the PCR of our control tubes and soil sample tube, we began to make the agarose gel that we will be using for gel electrophoresis in next week’s lab. In order to create a 40 mL 1.5%  T.A.E. solution agarose gel, we measured out 0.6 grams of agarose and added it to 40 mL of T.A.E. and swirled to begin to mix the solution. We microwaved the solution for 1 minute and 20 seconds, then let the erlenmeyer flask of our solution cool in a water bath at 55 degrees Celcius for 5 minutes. Then, we added 2 μl of ethidium bromide to the flask, swirled the solution to mix, then poured the solution into the gel rack to sit, cool, and harden into gel to be used for gel electrophoresis next week.

Each of the tubes from our PCR procedure are labeled “7” on the top of the lid and are labeled “+”, “-“, and “S” on the sides of the tubes for the positive control, negative control, and soil DNA tube, respectively. The positive control tube, negative control tube, and soil DNA tube were each placed in slots A1, A2, and A3 in the class’s rack, respectively. My group’s gel rack is labeled “Group 7, 1106-21” and has each of our initials: LHR, SGS, and KGI written on a piece of tape that is placed on the side of our gel rack. The gel rack was stored along with the other gels the other groups had made and was let out to sit and harden into a gel-like jelly on top of our lab counter. We cleaned up the rest of our lab station and returned all of the materials we used to their proper place in the lab room. We cleaned out our erlenmeyer flask with bleach and hot water after pouring our agarose solution into the gel rack. The flask was placed to the side on the counter next to the sink to dry. Below is a picture of our gel solution just after we finished pouring it into the gel rack. 

 

Conclusion:

We were able to work quickly and efficiently in this lab and we were even able to finish the lab procedures before the lab class time was finished. We had some good discussion at the beginning of class about the specifics of PCR amplification and we were able to clear up any confusion or misconception that we had on that topic.The discussion time at the beginning of class was extremely helpful because it allowed me to clearly understand the purpose of forward and reverse primers and how this process could allow us to sequence several copies of strands of DNA, specifically targeting the v4 region of the 18s rRNA We were also able to make agarose gel to be used in gel electrophoresis in next week’s lab. This was useful because the next step in our experiment would be to run gel electrophoresis for each of our control and soil DNA samples that we are able to amplify once we complete the PCR process. This will allow us to visualize our DNA strands and estimate their size and length in nucleotides when we compare them to the DNA ladder we will also run. I am looking forward to completing this procedure in next week’s lab!

 

Category: Lauren Robinson | LEAVE A COMMENT
February 23

PCR Amplification – 2/22/18

Rationale:

The purpose of this laboratory was to begin our amplification of DNA and begin the set up for gel electrophoresis. Additionally, the introduction emphasized how PCR primers work so that students can better understand what is going on, including the temperature cycles.

Method:

Procedure

Note: Use an aseptic method throughout the entirety of this experiment to minimize contaminates (ie. wipe down station with bleach, minimize movement, wear proper lab attire including gloves, use clean tips and swap after use between different solutions, keep tip boxes closed, etc.)

  1. Obtain 3, 12.5ul tubes of 2X master mix solution (containing buffers, nucleotides, and polymerase)
  2. Label the three tubes for positive control, negative control, and sample
    • Negative Control
      1. Add 1ul of Cox1 primers (stock 10 micromolar solution)
      2. Add 11.5ul of deionized water
    • Positive Control
      1. Add 1ul of Cox1 primers (stock 10 micromolar solution)
      2. Add 5ul of 10ng/ul culture
      3. Add 6.5ul of deionized water
    • Environmental Soil Sample
      1. Add 1ul of Cox1 primers (stock 10 micromolar solution)
      2. Add 5ul of unknown concentration environmental sample
      3. Add 6.5ul of deinonized water
  3. Place all three tubes in tray for use in the thermocycler, making sure to label tube and properly note the location of tubes on the tray
  4. Prepare gel for gel electrophoresis
    1. Add 40ml of 1xTAE to 0.6g of agarose gel in an Erlenmeyer flask
    2. Cover lightly and heat until clear (1 minute and 30 seconds at microwave power level 7)
    3. Let cool in bath until comfortable to hold
    4. Have a TA add 2ul of ethidium bromide and swirl gently
    5. Set up gel molding box with sealed sides and place comb in back towards nearest edge and pour agar solution into mold
    6. Allow to solidify for 25-30 minutes
    7. Store at 4° Celsius in plastic wrap until use

Observations:

Procedure Measurements

Component Negative Control Positive Control
Volume Soil DNA tube
2x Master mix 12.5ul 12.5ul 12.5ul
DNA Template 0ul 5ul (10ng/ul culture) 5ul (unknown concentration)
Primers 1ul 1ul 1ul
Water 11.5ul 6.5ul 6.5ul
Total Volume 25ul 25ul 25ul

Mass of Agarose Gel Used: (0.015) x (40ml) = 0.6g Agarose Gel

Storage

Positive Control:

Labelled “+ G1” on side and “1” on top

Stored in slot C1 of the tray

Negative Control:

Labelled “- G1” on side and “1” on top

Stored in slot C2 of the tray

Environmental Sample:

Labelled “Sample G1” on side and “1” on top

Stored in slot C3 of the tray

Gel:

Labelled “21-1 TCA”

Left at lab station for solidifying, however likely stored in freezer around 4° Celsius for later use

 

Conclusions:

This lab was really great for helping students see what goes into the amplification process, both in added solutions containing the necessary components as well as the intricate thermocyling methods. The next steps will be to use our samples and gel to complete gel electrophoresis to note the diversity of DNA in the samples. I am extremely excited for this step, as it will show the long -awaited information regarding our soil samples and protocols that these past few weeks have been leading up to.

Category: Timothy Small | LEAVE A COMMENT
February 23

PCR and Gel Electrophoresis 2/22/18

Purpose: To complete PCR using COX1 forward and reverse primers and to prepare an agarose gel to be used for future gel electrophoresis.

Procedure:

PCR Procedure:

  1. Determine the volumes of 2x Master Mix, DNA templates, primers, and water needed for our positive and negative control and for the experimental soil tube for PCR
  2. Disinfect lab surface and put on gloves for safety and to ensure there is as little contamination as possible
  3. Obtain 3 tubes that contain 12.5 ul of the 2x Master Mix and label one of them +, one of them -, and one of them test in order to differentiate them as your controls and experimental tube
  4. Transfer 5 ul of DNA template into the positive control tube using a p10 micropipette
  5. Transfer 5 ul of soil DNA into the test tube using a p10 micropipette
  6. Transfer 1 ul of COX1 primers into all three tubes using a p10 micropipette
  7. Pipette 11.5 ul of distilled water into the negative control tube
  8. Pipette 6.5 ul of distilled water into the positive control tube and the test tube
  9. Place all 3 tubes into the thermocycler, making sure to label the tubes with your group number and to take note of what spots they are in
  10. Denature the tubes at 94 degrees C for 4 minutes
  11. Let the tubes go alternate between 5 more cycles of: denaturation at 94 degrees C for 30 seconds, annealing at 45 degrees C for 1 minute, and extension at 72 degrees C for 105 seconds
  12. For the next 35 cycles, let the tubes alternate between: denaturation at 94 degrees C for 30 seconds, annealing at 55 degrees C for 1 minute, and extension at 72 degrees C for 105 seconds
  13. For the last 10 minutes, let the tubes sit at 72 degrees C to allow the DNA to reattach and form helices

Agarose gel procedure:

  1. Wear gloves the entire time, as some of the chemicals that are handled during this are mutagens
  2. Obtain an Erlenmeyer flask containing 40 mL of 1xTAE
  3. Weigh out 0.6 g of agarose gel powder and add it to the Erlenmeyer flask
  4. Lightly cover the flask with weighing paper and place the cap loosely on it
  5. Heat in microwave until the solution is clear and small bubbles come off the bottom when gently swirled
  6. Let the flask cool in a hot water bath for 5-6 minutes so that it is comfortable to hold
  7. Have a TA add 2 ul of ethidium bromide and swirl it gently
  8. Set up the gel electrophoresis box and pour the agarose gel into it. Label the box

Results:

For determining the volumes of the PCR components, our table looked like this:

Component Volume (+) Control Volume (-) Control
Volume Soil DNA tube
2x Master mix 12.5 ul 12.5 ul 12.5 ul
DNA Template 5 ul 0 ul 5 ul
Primers 1 ul 1 ul 1 ul
Water 6.5 ul 11.5 ul 6.5 ul
Total Volume 25 ul 25 ul 25 ul

The initial concentration of the stock primer was 10 uM, so the final concentration in our reaction was 0.4 uM.

The concentration of DNA in the + control was 10 ng/ul while the concentration of DNA in the soil tube was about 164 ng/ul; however, this number is more questionable

Our forward primer was 5′ ATGTGAGTTGATTTTATAGAGCAGA 3′, and our reverse primer was 5′ GGDATACCRTTCATTTT 3′

We labelled our 3 tubes “group 2” and put them in the thermocycler spots A7, A8, and A9.

We labelled our gel tray “group 2 MS, CC, WS”.

After finishing pouring our gel into the gel tray, we left it at our lab station so that the instructors could store it until next lab.

Next Step:

During the next class, we will run a gel on the soil samples to see if we can determine what kinds of ciliates are present in the soil.

Category: Waverly Shannon | LEAVE A COMMENT
February 23

Lab Week 7 Post – Polymerase Chain Reaction and Agarose Gel (02-22-18)

Task, Rationale, and Purpose: Lab week 7 introduced polymerase chain reaction (PCR) along with the construction of an agarose gel electrophoresis setup. The purpose of this lab is to be able to create multiple copies of a specific sequence from the DNA that the lab isolated from last week’s protocol. Secondly, the procedure calls for the set up for a gel electrophoresis experiment. The task or rationale for this week’s lab is to gain firsthand experience in PCR and gel electrophoresis experiments. For future labs and research, this knowledge is necessary for almost all fields of science.

Procedure:

  1. Ensure that the lab table is bleached and all participants are wearing gloves.
  2. Obtain three microfuge tubes containing 12.5 microliters of 2X master mix.
  3. Label one tube “+”, the second tube “-“, and the third tube “S”.
  4. Using a micropipette p10, add 1 microliter of Cox1 and Cox2 primer to each tube.
  5. Using a micropipette p10 with a new tip, add 5 microliters of the environmental DNA obtained from last week’s lab protocol into the S tube.
  6. Using a micropipette p10 with a new tip, add 5 microliters of positive control DNA into the + tube.
  7. Using a micropipette p20, add 11.5 microliters of DI water to the – tube.
  8. Using a micropipette p20 with a new tip, add 6.5 microliters of DI water to the + tube.
  9. Using a micropipette p20 with a new tip, add 6.5 microliters of DI water to the S tube.
  10. Place the tubes in the class tube rack and record their location on the rack and designate them with a group number and group initials.
  11. Begin the process of PCR by placing the tubes in a thermal cycler. Heat the tubes to 94 degrees Celsius for 4 minutes.
  12. Undergo 5 cycles of denaturation at 94 degrees Celcius for 30 seconds, annealing at 45 degrees Celsius for 1 minute, and extension at 72 degrees Celsius for 105 seconds.
  13. Undergo 35 cycles of denaturation at 94 degrees Celcius for 30 seconds, annealing at 55 degrees Celsius for 1 minute, and extension at 72 degrees Celsius for 105 seconds.
  14. Continue to keep the thermal cycler at 72 degrees Celsius for 10 minutes.
  15. Store the tubes at 4 degrees Celsius.
  16. Obtain 40 mL of 1xTAE (Tris Acetate EDTA) and add 0.6 grams of agarose to it in an Erlenmeyer flask.
  17. Cover the flask with a Kimwipe and a cap. Ensure the cap is loose.
  18. Heat the solution until bubbles form on the bottom.
  19. Cool the gel for 5-6 minutes.
  20. Add 2 microliters of ethidium bromide and swirl.
  21. Prepare a gel electrophoresis box.
  22. Pour the cool agarose gel into the mold and use a micropipette to pop any bubbles that form.
  23. Insert the comb into the furthest holder to the back of the box.
  24. Add the prepared 1xTAE buffer solution and remove the comb.
  25. Position the gel with the wells farthest from the positive electrode.
  26. Add 5 microliters of the ladder and 10 microliters of each PCR product with loading buffer into the wells. Ensure that each PCR product is in different wells.
  27. Put the lid on the box and turn the power on supplying it with 100 volts for 30 minutes at the minimum.
  28. Image the samples with a UV light.

Data/Results:

Tube rack Information: F1, F2, and F3; Group 8; KSA

Agarose gel electrophoresis box label: Room – A127, Teacher – Dr. Adair, Name – KSA

Gel electrophoresis results to be determined in next week’s lab

Storage: The final solution should be stored in the freezer.

Conclusion: The procedure was followed and completed successfully. There are a couple of errors, however, that the group had trouble with. Correct measurements were skeptical and one of the tubes was dropped. Additionally, an entire tray of micropipette tips was dropped. Regardless of the errors, the rest of the experiment continued flawlessly. Expectations for the electrophoresis results are low due to the amount of contamination in the original environmental DNA sample. For future studies, the protocol should be revised and enacted in a more professional and timely manner. For example, the addition of the materials into the microfuge tubes should be done in a fume hood to avoid foreign DNA contamination. Furthermore, hairnets and extra safety precautions should be enacted. Ultimately, the continuation of the gel electrophoresis experiment will commence next week.

Category: Angelo Wong, BIO 1105 31 | LEAVE A COMMENT