2/22/18

Today we amplified our extracted DNA then made the gel for the gel electrophoresis

Procedure

Preparing PCR:

1. Clean the countertop with bleach for sterile environment
2. Label 3 small tubes “-“, “+”, and “S”
3. Add 12.5 uL of 2x Master Mix, 1 uL of primer, and 11.5 uL of water to have a total volume of 25 uL in the tube labeled “-“
4. Add 12.5 uL of 2x Master Mix, 5 uL of DNA template, and 1 uL of primer, and 6.5 uL of water to have a total volume of 25 uL into the tube labeled “+”
5. Add 12.5 uL of 2x Master Mix, 5 uL of DNA template, 1 uL of primer, and 6.5 uL of water to have a total of 25 uL in the tube labled “S”
6. Label each tube with your group number

Creating the Agarose Gel

1.  In an Erlenmeyer flask add 40 mL of 1x TAE with 0.6 grams of agarose
2. Cover the flask with weighing paper and the top
3. Heat the flask in the a microwave for one and a half minutes on power 7
4. Take the flask out and place into a warm water bath for 5 minutes to cool
5. Add ethidium bromide to the solution (solution that allows you to see the DNA under UV light) and pour into gel tray.  Place the comb in after pouring the gel
6. Label the tray with tape and let the gel set for about 30 minutes

Observations

Cox 1 forward primer: 5′ ATGTGAGTTGATTTTATAGAGCAGA 3′

Cox 1 reverse primer: 5′ GGCATACCRTTCATTTT 3′

40 mL of 1.5 % of TAE is (40)(0.015)= 0.6 grams of agarose

Thoughts 

We were able to set up the gel so that can run the PCR procedure and then analyze the DNA.  I accidentally dropped all the tips for the 0.5-10 uL pipette and had to throw them all away because they were no longer sterile. (SORRY)

Positive tube labeled as “+” with the number 8 on it  stored in F1

Negative tube labeled as “-” with the number 8 on it stored in F2

Sample tube labeled as “S” with the number 8 on it stored in F3

Gel Tray labeled as “Sydney, Kaitlyn, Angelo group 8”