We worked on our presentation, a screenshot of which is attached below

Today we worked on an abstract for our research project:

Analysis of Alternative Clustering Methods for Arthrobacteriophages

Abstract: The study of bacteriophages includes an investigation of their DNA. An important aspect of DNA analysis is clustering, the means by which discovered bacteriophages are sorted according to genome similarity. The current method for clustering is an analysis and comparison of a bacteriophage’s full genome. However, this presents several limitations for clustering, as it requires the completion of full-genome sequencing and the production of a high-titer DNA lysate. In the interest of easing the clustering process, additional clustering methods were analyzed including sorting by G/C content and clustering by Tape Measure Proteins (TMP). Through comparison to existing clusters, it was determined that the G/C content of phage clusters group too closely to be useful for clustering. However, through the use of a Gepard dotplot, it was determined that there is enough similarity among TMPs within clusters and enough diversity between clusters to facilitate that clustering method. From this, we used cluster TMP alignments generated by Mega7 to find conserved regions within each genome. From these, small PCR primers were created that were specific to each cluster’s TMP with minimal off-target similarity. These will allow future researchers to determine the clusters of bacteriophages with a minimal sample of DNA earlier in the process without going through whole genome sequencing. In conclusion, TMP analysis is a highly effective alternative clustering method with the added benefit of PCR primers, which offer the benefits of less lab work and the ability to sort phages with a low titer DNA lysate.

Today, we went cluster by cluster checking all the primers against the clusters to ensure that no off-target binding occurs. This was done with the DNA Master Scan function set at a sensitivity of 80%. This ensures that the maximum tolerated similarity will be at that level and all hits above that level will be reported to us. Once checked, adjustments were made to ensure no off-target binding with the most difficult matches being the two subclusters of the AO cluster. These share a lot of similarity, making it very difficult to design primers that don’t bind to the other cluster. Once this was completed, we had a confirmed list of primers with a range of product sizes from 204 up to 1000bp that are spread by more than 30bp between each allowing resolution of each individual product size. Therefore, on a gel electrophoresis of PCR product, a researcher could use these primers to type their phages in lieu of sequencing or prior to sequencing.

This chart presents each of the cluster’s primers and their associated product sizes.

Today I split my time between two sections. I spent the beginning of class discussing and demonstrating the operation of Gepard with team 3 to aid them in creating and analyzing FASTA files for their independent project. Once they had a slight redesign, our team decided to adjust our project too. With the previous project results and some more primary source reading from the initial article, we decided to pursue a primer design project for the TMP genes within Arthrobacteriophages. As a proof of concept, we designed primers for the AL cluster, using a TMP alignment. This produced a forward primer (AAGGACTACACGGGCCTGAC) and a reverse primer (TGATGAAGCTGGGTACTGACC) with a product size of 292. This confirmed an ability to do this Arthro phages.

Example of the alignment (AL Cluster) that is used to design primers. The “*”s represent regions of 100% conservation.

Today I split my time between two sections. I spent the beginning of class discussing and demonstrating the operation of Gepard with team 3 to aid them in creating and analyzing FASTA files for their independent project. Once they had a slight redesign, our team decided to adjust our project too. With the previous project results and some more primary source reading from the initial article, we decided to pursue a primer design project for the TMP genes within Arthrobacteriophages. As a proof of concept, we designed primers for the AL cluster, using a TMP alignment. This produced a forward primer (AAGGACTACACGGGCCTGAC) and a reverse primer (TGATGAAGCTGGGTACTGACC) with a product size of 292. This confirmed an ability to do this for Arthro phages.

Today, we focused on an ability to cluster by G/C content. To do this, we sorted all of the G/C contents for the phages in each cluster and then sorted and averaged them within their clusters. Though the G/C content within each was strongly conserved with a few exceptions, there was a clustering of the G/C contents at around 60-65%, which prevents this method from playing more than an advisory role in clustering.

Leading into today, the TMP sequences for clusters AK-AU were found and recorded in a multi-FASTA file. These were found by using an annotated DNA Master document pulled from PhagesDB and then extrapolating onto the other members of that cluster. Three phages were used in each cluster unless only two were available.  During this lab meeting, we annotated the AV cluster phages for their TMP sequence. There was an existing cluster AV annotation (Jasmine) but it didn’t classify a TMP. There were several genes of substantial enough length to be a TMP, which we then blasted to find a function. We ended up settling on it being gene 29. It had an appropriate length (5412) and a weak hit (E-value=.013) to a different cluster’s TMP. With no other alternatives lacking a function, this was selected as our TMP for this cluster. This gene was strictly conserved (E-Value=0.0) across all the cluster’s phages we are using.

Once we collected all of the TMP sequences in a multi-FASTA file, we created a Gepard dotplot for the TMP sequences and compared it to a Gepard plot. It reflected similar cluster boxes with slightly less strength. Lymara, an AR phage was inserted into the top of these to verify that each are capable of clustering an “unknown” phage. Both methods exhibited this capability, indicating the capability to cluster by TMP.

TMP Clustering Example

Full Genome Clustering Example

Today we developed ideas for the project based on an existing article that piqued interest. What we intend to pursue is analyzing the ability of how to cluster by tape measure proteins in Arthrobacter clusters and see if the single gene analysis implies the same evolutionary history as whole genome alignment (which is seen through the current cluster names).

In utilizing bacteriophages for medical therapy, there are a number of concerns that would need to be considered before a certain phage or phage cocktail is approved and used on live patients. Some of these concerns are concerns that can be tested and alleviated prior to the use in humans. If I were designing an approval protocol for phage therapies, the central test would be its ability to destroy the host bacteria without allowing for or causing the development of a resistant strain. With antibiotic resistant bacteria representing a cautionary tale against reckless unchecks therapy usage, I think it would be valuable to utilize bacteriophages that maintain their efficacy over time. This test ensures that the bacterial immune system can be overcome in a way that prevents or, at the very least, strongly mitigates, the possibility of a bacteriophage resistant bacteria developing in humans or in treatment centers, which are already working to tackle and control antibiotic resistance. The other concern I would like to see considered, though not necessarily tested against is the once-off nature of each individual therapy. When the immune system encounters, the bacteriophages, it will begin the generation of immune antibodies to the phages used to treat the infection. This prevents the use of the same phage drug with the same patient more than once. This means that a phage must either be able to completely clear the infection within a single run or two tight dosages or that a new phage or phage cocktail must be ready for a second dosage to clear any of the bacteria that weren’t cleared by the first one, for whatever reason. The human immune system is a complex system, and by introducing a second replicating, though not technically living, entity to treat a first, there is an immensely complex relationship playing out that needs to be studied and understood before irreparable changes are made. An approval process allows for that relationship to be understood for each individual treatment option before it is used.

In this section of the Forgotten Cure, readers find Kuchment’s discussion of phage research in a variety of different locations, including the US, Soviet Union, Poland, and India. The discussion of the research occurring in each of these locales allows readers to observe the different factors that can affect researchers ability to conduct research.

The first location of research discussed is the soviet union, which helped to highlight the societal infrastructure and attitude that is useful for promoting a particular form of research. This is seen in that country’s wariness over the pharmaceutical industry. Despite the fact that Western researchers attempted to offer the USSR access to antibiotics, the populace preferred a more natural medicine. This was largely due to the government’s prior attempts to discourage trust in the pharmaceutical industry. The social climate in the Soviet Union fostered increased bacteriophage research, allowing the Tbilisi research group to flourish.

The situation discussed in Poland allowed Kuchment to highlight the impact that a dedicated team or institution can have regardless of the societal situation. The institute based in Wroclaw was able to conduct valuable and impactful research within the country, even though the primary emphasis in the country was on using antibiotics. This simply meant that the group, and the following outpatient treatment center focused on the ever-increasing problem of antibiotic resistance. This is research that, even today, is valuable for its ability to supplement the limitations of the cutting edge of medicine. The longevity of this research demonstrates the importance of finding a useful and significant niche in the research culture that allows research to continue even if alternative and competing scientific research is being completed.

The US and India were established in a way in Kuchment’s book that allowed them to contrast the political and regulatory environments in each country. The collapse of the group that was founded in Baltimore (though the research was conducted on the grounds of the Eliava Institute) demonstrated the difficulty that the US culture can pose to any potential researchers. The emphasis on contractual obligations, legal coverage, and profitability leads to a cut-throat relationships, which, as demonstrated by the group founded in Baltimore, can contribute to collapse. A contrasting story is presented from India. Ramachandran, inspired by the TV airing of a documentary uncovered the potential for phage therapy to help the developing India. With this knowledge he established his own genetic therapy research group, based in India for cost and access to people. Even independent of much external help, he was able to build a genetic therapy from scratch in the looser regulatory climate and attract investors. The company he founded, Gangagen, is still active and producing important research on combating drug resistance with bacteriophage treatments. An example of some of their most recent research is the development of the phage P128 for topical application to kill a vast range of Staphylococcus aureus strains. This success is in staunch contrast to the group founded in the US climates, which failed shortly after it got off the ground. This indicates the importance of the regulatory and business environment a research group starts and operates in.

This section of the book discussed some fascinating research projects that allowed me to observe and analyze the importance of different elements to the research process.