Climate Change is one of the most important topics for our generation, in today’s deliberation we primarily talked about three major aspects of actions that we can take in response to the impacts of climate change. I personally agree that all three are important, however, the degree of implementation for them are different. For option 1, I agree that immediate action should be taken to help reduce human impact on the environment, but sacrificing personal freedom to achieve the goal is overstepping the boundaries, the ends don’t justify the means, no matter how important the goal is. Prepare and protect our communities is crucial to prepare for the impacts of climate change since it can bring drastic change to our neighborhood and industries, improving the infrastructure and renewing disaster protocols in case of extreme weather are definitely on the top of the to-do list for this category. I believe the only way to fundamentally eliminate this crisis is to innovate the energy industry and waste disposal protocols, most people wouldn’t switch to more expensive, inconvenient ways of lifestyle just because climate change one day might cause a drought in Africa and kill thousands of people, so new incentives must be provided if the “Green” way wants to be adopted by the general public. If a cleaner, cheaper, more efficient way to do work is found, carbon emissions will definitely drop drastically, while the what’s done previously would persist further damage to the environment would be prevented, and in time the negative effects of human interference to the planet will subside.

One of the biggest problems in phage therapy has been in the approval process. Describe the trouble surrounding FDA approval and recommend some suggestions to improve the process of phage therapy approval.

For a potential drug to reach the market, statistics from the book show that only as few as eighteen percent of the medicines that make it to phase I continues on to succeed, and the average costs for drug development and approval are 8 hundred million dollars. For phage therapy, sufficient funding has always been a problem, furthermore, large pharmaceutical companies targets treatments for chronic, more profitable diseases rather than short term, low-profit treatments such as phage therapy.

Since phages are capable of mutation, the phage cocktails in phage therapy may have to change or adjusted every few years, while antibiotics remain the same formula for decades and exact mechanism can be studied thoroughly, the FDA might be concerned about the safety or stability of phage therapy. Some of the concerns surrounding phage therapy are that bursting bacterial cell might release toxins and cause septic in the patient’s body, and the phages that burst out of the cells carrying drug-resistant genes might infect other bacterial cells and transfer the genes to other bacteria via transduction. One of the ways that scientists can help prevent this from happening is to keep the phage particles within the dead bacterial cell, such as Ramachandran endeavor to prevent toxins leaving the cell by inactivating endolysin.

Besides scientific research, one of the most important things for the approval of phage therapy is to convince doubters the effectiveness and importance of phage therapy, the process would be easier of people are more accepting of the concept,

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• DNA Master
• NCBI & Phagesdb Database
• Phamerator

Procedure & Results:

1. The abstract was revised with the comments from the last abstract submission.
2. Primary literature that provides insights to the project was found.
3. Presentation powerpoint outline and graphs were compiled.

The hypothesis was supported by the new literature found in the lab. The final abstract version was revised and submitted.

The Next Step:

The next lab would be to try to complete the powerpoint and practice the presentation.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• DNA Master
• NCBI & Phagesdb Database
• Phire

Procedure & Results:

The NapoleonB genome was analyzed on DNA Master for promoters(sigma-70), the complete result

hasn’t been analyzed yet, however online promoter finders didn’t back up the hypothesis of the sequence being a promoter. Phage promoters don’t have a complete database so the result is expected.

The group has written an abstract for the project during lab after discussion:

Repeats in genomics have a wide variety of significance, from signifying the start of a transposable element to being the terminator for a gene. In a newly sequenced and annotated bacteriophage, NapoleonB, a 46-base pair sequence that was repeated twice was found at around 25,500bp and 26,165bp in a non-coding region. The sequence was analyzed to see if evidence was present for multiple functional elements, as well as compared to other AM cluster phages to search for similarity. Tools such as Gepard, NCBI’s BLAST, Clustal Omega, IS Finder, attP site finders, and others were used to try and match the sequence of interest to a potential function. The sequence was also found to have 4-6 base pair flanking inverted repeats, which piqued research interest towards a possible transposable element or promoter. Using the previously mentioned tools, we were able to rule out the notion that the sequence was a transposon, attP site, or an overlooked ORF or protein. However, with the sequence found to have been conserved across 11 of 14 AM cluster phages, it was concluded that the likelihood of the sequence occurring as observed at random was extremely low. Therefore, the leading remaining hypothesis that this repeat could function as a regulatory sequence or promoter seemed promising. In order to definitively confirm or rule out the possibility of a regulator sequence at this stage, the sequence would have to be removed in an in vitro setting and the following genes observed.

The Next Step:

The next lab would be to analyze the data in DNA Master and hopefully find supporting evidence for the hypothesis.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• DNA Master
• NCBI & Phagesdb Database

Procedure & Results:

The sequence was not backed by transposon finder software(IS finder), the project was then discussed with coaches and the remaining possibility for a conserved sequence within a cluster might be a recognition site for gene transcription such as a promoter.

The sequences were all found in front of the gene of the same pham in the AM cluster, which further supports the hypothesis.

The Next Step:

The next step would be to try to find supporting evidence that backs up the new hypothesis.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• Gepard dot plot software
• DNA Master
• NCBI & Phagesdb Database

Procedure & Results:

The repeats were located on each of the AM phages that have the sequence, the sequence is indeed found to be flanked, however, the flanks are very short and transposons have longer sequences that flank them, so it’s difficult to draw the conclusion that they are indeed transposons. The new hypothesis is since the repeat is in the non-coding region it might be a regulatory sequence for subsequent genes since they are all found in front of the gene in the same pham.

The Next Step:

The next lab would be to try to find evidence to support the hypothesis that the repeat regulates genes downstream.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• Gepard dot plot software
• DNA Master
• NCBI & Phagesdb Database

Procedure & Results:

A particular 51 bp repeat in the NapoleonB genome was found and inverted flanks were found at both sides of the repeat, which lead to the hypothesis that the repeat may be a relic of a transposon:

AGAAGACGAAGACTACTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATCACAAGGGGTATAATGAACCCACCTATGAAAGGAATTAAAATGATTACCCCTAATATGCAGGAACTTATCGCTAAACGCGAGAAGGCCATCATTGAGCAACAAGATTTGTTCATAGCTATCAAGGCATTATCCACAGATCCGGAAACAGCCGGACGCCTGTTGGTAAAGCTGACTGATAGCACGTGCGAATATGTTGATGCTCAAACCGACCTCCTCGAACTTTACGCATTTGTACCCGAAAAGAAAGAAACGATCATTAAGAGACTATTTAAGAAGTAACGTTCAAGACTATAGACCCTACAAGGTTTATAGTTTTTGACCATCGCGTAAATTACAAGGGGTATAATGAACCCACTATGAAAGGACCAGAAAATGGAAAAGTCAAAAAAGCAGAAGCTCAAGGAATTCGCTAAGAAAGAACTCCCTTGGATTGCGATGACCGCAGTAACCATGACCGCTATCGTTGTAGTTTTTAAGAACCACCTCGATACGCAAGAAGAAACCTACCGCGAACATCTCGAAGAACGGAACGACATCTACAACCATACCGTGAGCCAAGCTTATGAACAACTATTTAACGGAATTCTAAACAAGTTGGAAAATCAAAATTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATTACACG

However, the repeat is found in the non-coding region and blast results show that the repeat has no known function. The sequence is found in 11 of 14 AM phages and not found in the genome of the Athrobacter host.

More insights are needed to draw a better conclusion from these findings.

The Next Step:

The next lab would be trying to learn more about this repeat and the genes around it.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• Gepard dot plot software
• DNA Master

Procedure & Results:

1. Scientific literature that relates to the topic were found and treated as reference.
2. More repeats within the NapoleonB genome were found.
3. A new method for a more efficient way to scan for repeats may be needed.

QTM for lab was written:

Presentation Title (Can be changed): Discovery of repeats in Arthrobacter phages and examination of potential functions.

Two research articles discussing your area of research

• https://jb.asm.org/content/193/19/5300
  • Shows that tail protein areas should be examined to find potential repeats
• https://www.ncbi.nlm.nih.gov/pubmed/29204885
  • Discusses tail fiber domains (in relation to a repeat found after a minor tail protein)

Guiding Research Question (include any background information relevant to the question)

Is it possible to use repeats in coding or noncoding regions of the genomes within the AM phage cluster to predict the functions of genes with no known functions?

Three bioinformatic tools you plan to use in your research

• DNA Master Scan
• Gepard
• Phamerator
• Clustal Omega

You will be presenting your findings at the CURES in Biology Symposium on Friday, May 3. You will do a ‘practice presentation’ on May 1st to your coaches. There are 7 lab days before the May 3rd presentation. While most of your research can be completed during class, presentation practice and presentation design will need to be worked on outside of class. With this in mind, formulate a schedule with ‘check points’ for your group to make sure you stay on track during this busy time of the year. Dates of lab meetings have been provided, but if you plan to meet outside of class as well feel free to include those times.

4/8 – Look for repeats and deepen understanding of prospective repeats that are being investigated

4/10 – Select most promising repeats to focus on and find more information and research to give meaning to the sequences found

4/15 – Apply findings to other AM Cluster phages and begin to finalize data and observations

4/17 – (by the end of lab) Have concrete findings (positive/or negative) that can serve as an answer to the question

4/22 – Compile data and results & create graphics to display findings

4/24 – Organize findings and research into presentation form

4/29 – Finish and revise presentation

5/1- Practice Presentations

5/3- CURES in Biology Presentations 2-5 pm

The Next Step:

The next lab would be to look for repeats and deepen understanding of prospective repeats that are being investigated.

Rationale:

To prepare for the coming URSA poster presentation, the pairs doing the presentation together present the poster in lab as practice, and the whole lab can provide feedback to improve the overall presentation.

Materials:

• Poster

Procedure & Results:

Two of the students in lab that signed up in the same time slot presented the poster together in lab. (preferably in 5 minutes) Then the listeners ask questions or provide feedback to the presenters.

The Next Step:

In the next lab, the independent research project will be resumed.

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:

• Laptop
• Canvas Bio-Lab info page
• Gepard dot plot software

Procedure & Results:

After looking for repeats in the NapoleonB genome, an outline of the question is generated,

Outline:

1.      Locate and identify and significant repeats in NapleonB’s genome
2.      Cross-check those repeats with other AM cluster phages
3.      BLASTn any significant repeats to check for similarity with NCBI database
4.      Check if any conclusions can be made with non-coding regions, protein similarity, NKF genes, etc.*

Tools*: Gepard, NCBI BLAST, DNA Master, Clustal Omega

*will be expanded

The Next Step:

The next step would be looking for initial points of interest in the NapoleonB genome, to find a incision point for the research to begin.