April 12

Collecting Start Codons for Research Project (4/10/19)

Rationale: 

Start codons for the phages 0f the AQ cluster were collected.  

Tools:  

  • PhagesDB 
  • DNA Master 
  • Excel 

Procedure:  

  1. FastA file was downloaded from PhagesDB 
  2. File was opened in DNA Master.  
  3. Start Sequences of phages were noted on Excel.  
  4. Genomes of AR Cluster phages were copied onto a word document to help in creating a phylogenetic tree.  

Results:  

More start codons for AQ Cluster phages were collected: 

Conclusion:  

There were similarities of start codon preferences found in the start and end of the phage AQ and all that were recorded had 82 genes. There could be some kind of trend that is present between all phages in a cluster, and maybe in between clusters. 

Future Work:  

More start codon sequences will be collected and be used to create a phylogenetic tree.  

Category: Sona Subramanian | LEAVE A COMMENT
April 12

Data Collection/ Research Papers for Independent Research Project (4/8/19)

Rationale:

Start codons for AR cluster phages were collected, and research articles were searched to be used for project.  

Tools:  

  • DNA Master 
  • PhagesDB 
  • Excel 
  • Baylor OneSearch  

Procedure:  

  1. Collection of start Codons for AM Cluster phages were completed.  
  2. Research Articles were explored through Baylor OneSearch, and bibliographies for the five articles were created.  
  3. AR cluster phage start codons were collected.  

Results:  

More data was collected for start codons, and more articles were found.  

Conclusion:  

Some unique characteristics found among all of AM Cluster phages were noted such as the start sequences of the last four genes of every phage were the same.

Future Work:  

More start codons for phages of other clusters will be collected in hopes of finding similarities between phages and clusters to further cluster the phages.  

 

Category: Sona Subramanian | LEAVE A COMMENT
April 11

DNA Day 21

10 April 2019 ✷ Independent Research (again)

Rationale: The trends in the percent GC of the genes were analyzed via statistical methods and further research plans were decided upon to answer the research question

Procedure

  • The genes were sorted by whether or not they were specific to AM and then averages and statistical analysis was performed by Lucy.
  • In the search for a phage that was most similar to NapoleonB but from another cluster, group members noticed that the Pham numbers had changed and that more phages had been added, thus the data from the previous lab regarding the stats on the AM vs non-AM genes needed to be redone.
  • Phams were checked against PhagesDB and the results were updated.

Results

Pictured is the data recorded today.



 


Conclusion


The P score for the average %GC of AM-specific genes vs non-AM-specific genes is low enough to indicate a significant difference between the two.


Future plans


Find more data!

      

                 

	Category: Lily Goodman | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
DNA Day 20

      


		

		
8 April 2019 ✷ Independent Research


Rationale:  Groups began work on their projects. The genome of NapoleonB was scrutinized to answer the question on the relationship between its genes that were AM-phage-specific and genes that were present in non-AM phages and percent CG.


Procedure


    

  • The new annotations (including inserted genes) was added into the DNA Master file for NapoleonB and the percent GC and GC3 of each gene was calculated by DNA master and recorded by group members.
    • 

  • The genes were sorted by whether or not they were specific to AM and then averages and statistical analysis was performed by Lucy.
    • 

  • This procedure was repeated for a phage from a different cluster.
    • 

  • The average %GC for the entire genome (rather than by each gene) for all the clusters was provided by PhagesDB and statistical analysis was performed with this information as well.
    • 



Results




Pictured is the data recorded today.




 


Conclusion


AM phages have the lowest % GC of all the clusters. The genes that are AM specific seem to have a lower percent GC than those genes that exist in other clusters.


Future plans


Find more data!

      

                 

	Category: Lily Goodman | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
Major tail protein structural analysis 4/10

      


		

		
Rationale: Begin major tail protein structural analysis and to finish hard data for both minor tail proteins and tail proteins.


Procedure: DNA Master, PhagesDB, Google Sheets, and SWISS-MODEL Workspace were used to in major tail protein structural analysis. Obtained amino acid sequence from PhagesDB and uploaded the sequence to SWISS-MODEL Workspace and the structures were produced. Analysis of sturures were performed and lots of differences were found.


Results:  


Heisenberger 15 Major tail proteins both with the start AUG


 




some of the tail proteins hard data were obtained but not all. One of these tail proteins had a 399bP length, and that is really small for a tail protein. More research on this will have to be done to see why this particular protein is extremely small compared to the others.


Conclusions: When the Heisenberger 15 amino acid sequence was placed into SWISS-MODEL Workspace, these were 2 of the 3 structures produced. Two of the structures were the same but as you can see from the results, two are different, and they both have the same amino acid with the preferred starts. More work is being done to analysis the different structures of the major tail protein. Changing the starts of some tail proteins had no effect to the overall structures, but some proteins had different structures just from the preferred start site.


Future work: Begin tail protein and minor tail protein structural analysis. Finish both tail proteins and minor tail proteins hard data by using PhagesDB and DNA Master.

      

                 

	Category: Michael Lum | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
Preparing for SEA-PHAGES Symposium (4/10/19)

      


		

		
Rationale:


Analyze endolysins and holins to collect more data to create a presentation to present at SEA-PHAGES symposium.


Procedure:


    

  1. Printed out and analyzed RaptorX structures created previously.
    2. 

  2. Outlined SEA-PHAGES symposium presentation.
    3. 

  3. Used Blender to model holin’s hole formation.
    4. 



Results:


The following images shows the endolysins and holins structure predicted with RaptorX.




The following image shows the unfinished holin creating holes in the plasma membrane model.




Conclusion:


Compared with Multiple Sequence Alignment and phylogenetic tree results, the predicted protein structure visualized with RaptorX revealed that there are although sequences were quite similar, the structures varied.


Future Work:


Finish creating presentation and present poster and presentation at SEA-PHAGES symposium.

      

                 

	Category: Kathryn Adkins | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
Sequencing Alignments, Folding Proteins, and Discovering NapoleonB’s Endolysin’s Catalytic Site (4/8/19)

      


		

		
Rationale:


Start analyzing endolysins and holins in the AM cluster.


Procedure:


    

  1. Performed Multiple Sequence Alignment with AM cluster endolysins along with FF cluster phage Elesar’s and FE cluster phage Corgi’s endolysins.
    2. 

  2. Performed Multiple Sequence Alignment with AM cluster holins along with BI cluster phages Madamoto’s and Bing’s holins.
    3. 

  3. Folded protein structures with RaptorX.
    4. 

  4. Explored and discovered NapoleonB’s endolysin’s catalytic site with Jmol.
    5. 



Results:


The following image is the results from Multiple Sequence Alignment with AM cluster endolysins along with FF cluster phage Elesar’s and FE cluster phage Corgi’s endolysins from Clustal Omega.




The following image is a phylogenetic tree from endolysin Multiple Sequence Alignment.




The following image is the results from Multiple Sequence Alignment with AM cluster holins along with BI cluster phages Madamoto’s and Bing’s holins from Clustal Omega.




The following image is a phylogenetic tree from holin Multiple Sequence Alignment.




The following image shows NapoleonB’s endolysin’s catalytic site.




Conclusion:


The Multiple Sequence Alignment and phylogenetic tree show high similarly between phages. NapoleonB’s endolysin’s catalytic site, which has the responsibility to cleave the bacterial host’s peptidoglycan membrane, appears to be located in beta-sheets.


Future Work:


Predicted endolysin and holin structures will be analyze more.

      

                 

	Category: Kathryn Adkins | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
Independent Research Projects 4.10.19

      


		

		
Rationale:


To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.


Materials:


    

  • Laptop
    • 

  • Canvas Bio-Lab info page
    • 

  • Gepard dot plot software
    • 

  • DNA Master
    • 

  • NCBI & Phagesdb Database
    • 



Procedure & Results:




The repeats were located on each of the AM phages that have the sequence, the sequence is indeed found to be flanked, however, the flanks are very short and transposons have longer sequences that flank them, so it’s difficult to draw the conclusion that they are indeed transposons. The new hypothesis is since the repeat is in the non-coding region it might be a regulatory sequence for subsequent genes since they are all found in front of the gene in the same pham.


The Next Step:


The next lab would be to try to find evidence to support the hypothesis that the repeat regulates genes downstream.

      

                 

	Category: Yang-En Yu | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
Independent Research Projects 4.8.19

      


		

		
Rationale:


To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.


Materials:


    

  • Laptop
    • 

  • Canvas Bio-Lab info page
    • 

  • Gepard dot plot software
    • 

  • DNA Master
    • 

  • NCBI & Phagesdb Database
    • 



Procedure & Results:


A particular 51 bp repeat in the NapoleonB genome was found and inverted flanks were found at both sides of the repeat, which lead to the hypothesis that the repeat may be a relic of a transposon:


AGAAGACGAAGACTACTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATCACAAGGGGTATAATGAACCCACCTATGAAAGGAATTAAAATGATTACCCCTAATATGCAGGAACTTATCGCTAAACGCGAGAAGGCCATCATTGAGCAACAAGATTTGTTCATAGCTATCAAGGCATTATCCACAGATCCGGAAACAGCCGGACGCCTGTTGGTAAAGCTGACTGATAGCACGTGCGAATATGTTGATGCTCAAACCGACCTCCTCGAACTTTACGCATTTGTACCCGAAAAGAAAGAAACGATCATTAAGAGACTATTTAAGAAGTAACGTTCAAGACTATAGACCCTACAAGGTTTATAGTTTTTGACCATCGCGTAAATTACAAGGGGTATAATGAACCCACTATGAAAGGACCAGAAAATGGAAAAGTCAAAAAAGCAGAAGCTCAAGGAATTCGCTAAGAAAGAACTCCCTTGGATTGCGATGACCGCAGTAACCATGACCGCTATCGTTGTAGTTTTTAAGAACCACCTCGATACGCAAGAAGAAACCTACCGCGAACATCTCGAAGAACGGAACGACATCTACAACCATACCGTGAGCCAAGCTTATGAACAACTATTTAACGGAATTCTAAACAAGTTGGAAAATCAAAATTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATTACACG


However, the repeat is found in the non-coding region and blast results show that the repeat has no known function. The sequence is found in 11 of 14 AM phages and not found in the genome of the Athrobacter host.


More insights are needed to draw a better conclusion from these findings.


The Next Step:


The next lab would be trying to learn more about this repeat and the genes around it.

      

                 

	Category: Yang-En Yu | LEAVE A COMMENT           

	    


    
    


      

                     April
                     11
                 

      
4.10.2019 Investigating the Possible Transposon

      


		

		
4.10.2019 Investigating the Possible Transposon


Rationale: Since we hypothesized that a transposon may be the cause of our highlighted repeat, it was beneficial to take a closer look to examine the evidence to see what it supported.


Procedure: The same tools (DNA Master, Phamerator, NCBI BLAST, and HHPred) were used to process data about this repeat and to begin to draw conclusions about it.


Results: Today’s results were less than encouraging. NCBI BLAST did not match the repeat to anything other than bacteriophages, which makes the notion that the possible transposon was from a different organism improbable. HHPred did not match to anything significant, and DNA Master offered no further results for the sequence other than the other members shared the same TAAA inverted repeat on either side of the sequence.


Conclusions: Since the other evidence supporting a transposon or a transposable element is not present, the initial thought that the repeat is a transposon may be incorrect. This would be difficult, as it would leave many more questions than answers about what kind of function this noncoding region could have.


Next Steps: Despite the negative results, the theory that the sequence is the result of a transposon is not completely debunked. More tests and analyses need to be run before a definitive conclusion can be made.

      

                 

	Category: Henry Burns | LEAVE A COMMENT