April 11

Independent Research Projects 4.8.19

Rationale:

To understand more about phage, the class was divided into several small groups to generate research questions that utilize bioinformatic tools to learn more about questions about NapoleonB and/or related phages.

Materials:
  • Laptop
  • Canvas Bio-Lab info page
  • Gepard dot plot software
  • DNA Master
  • NCBI & Phagesdb Database
Procedure & Results:

A particular 51 bp repeat in the NapoleonB genome was found and inverted flanks were found at both sides of the repeat, which lead to the hypothesis that the repeat may be a relic of a transposon:

AGAAGACGAAGACTACTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATCACAAGGGGTATAATGAACCCACCTATGAAAGGAATTAAAATGATTACCCCTAATATGCAGGAACTTATCGCTAAACGCGAGAAGGCCATCATTGAGCAACAAGATTTGTTCATAGCTATCAAGGCATTATCCACAGATCCGGAAACAGCCGGACGCCTGTTGGTAAAGCTGACTGATAGCACGTGCGAATATGTTGATGCTCAAACCGACCTCCTCGAACTTTACGCATTTGTACCCGAAAAGAAAGAAACGATCATTAAGAGACTATTTAAGAAGTAACGTTCAAGACTATAGACCCTACAAGGTTTATAGTTTTTGACCATCGCGTAAATTACAAGGGGTATAATGAACCCACTATGAAAGGACCAGAAAATGGAAAAGTCAAAAAAGCAGAAGCTCAAGGAATTCGCTAAGAAAGAACTCCCTTGGATTGCGATGACCGCAGTAACCATGACCGCTATCGTTGTAGTTTTTAAGAACCACCTCGATACGCAAGAAGAAACCTACCGCGAACATCTCGAAGAACGGAACGACATCTACAACCATACCGTGAGCCAAGCTTATGAACAACTATTTAACGGAATTCTAAACAAGTTGGAAAATCAAAATTAAAGCTATCAGCCCCTAACACGGGCTATAGTTTTTGTTCGTCGCGTAAATTACACG

However, the repeat is found in the non-coding region and blast results show that the repeat has no known function. The sequence is found in 11 of 14 AM phages and not found in the genome of the Athrobacter host.

More insights are needed to draw a better conclusion from these findings.

The Next Step:

The next lab would be trying to learn more about this repeat and the genes around it.


Posted April 11, 2019 by joseph_yu1 in category Yang-En Yu

Leave a Comment

Your email address will not be published. Required fields are marked *

*